Aside from D. paradoxa.......

[jimscott]

.... which other Petiolaris Complex will tolerate temps as low as the 80's and 90's? I have a fishtank and a submercible heater, and a fluorescent light set up with lowland Neps, B. liniflora, and a D. lanata. I just got hold of a piece of styrofoam that I will cut to size and contour of plastic plant pots so that they will float on the water. Should the Petiolaris plant pots be submerged in the water at all and by how much or should the bottom of the pot be at the surface or slightly above the surface and by how much? Would D. ordensis be okay in this temperature? What other Australian sundews would benefit in this glorified terrarium setup?

 

[rattler]

i would theink they would all do ok.....falconeri shouldnt have any problems........

 

[Jefforever]

I grow Lanata, Paradoxa, Petiolaris, Dilatato petiolaris, Aff. Ordenensis, Falconeri, and a couple other things always under 80 - 90 degrees.

I just don't know which is which, so they're not listed on my growlist. :-(

 

[Pyro]

Once upon a time there was a blurb in CPN about growing petiolaris complex floating in heated water. Might want to check the archives if you have the time.

My tanks are heated to about the range you describe. However, I don't float the plants as I like to let the water level flux for them. Plus, I have plants go dormant under my conditions and a floating plant would rot out in a minute if it were to go dormant.

 

[Clint]

I HATE their haphazard dormancy! Remember when I sent them to you because I thought they were going to kick the bucket? I would like to try again in college some time. It's much easier to heat than it is to cool. Someone should try growing something disposable like D. paradoxa floating in water; that sounds very interesting.

As for myself? To the ARCHIVES archives archives archives.... I couldn't find it via the public search and going through each back issue on the member's site would take forever. I don't think you can search them anyway. And I don't actually know the difference between the public search and the member's area.... dun dun duuuuun.


Whatever happened to Chuck? Nice guy! Hope he's alright.

 

[Pyro]

I recall the ones you sent me. Under my conditions they all turned around

I know I have the CPN in question at home, I'll try to get around to looking through them tonight but my usual routine these days it to pull the computer out and continue writing and once I start I tend to lose track of time....

I think Chuck may be gone from the game. Rumor is his eBay dealings went really really bad and no one has heard from him since then...

 

[jimscott]

How about suspended just above the water line so that the evaporation creates a nice, humid environment? The styro attempt failed. It was too flimsy.

 

[Pyro]

Why not try my method? Get a bit of light diffuser and elevate it by placing pots underneath it. The just fill with enough water so the plants are only standing in about 2-4cm..

 

[jimscott]

Actually, I am trying to do some semblence of your method, only I have to go cheap. I don't even know what a light diffuser is. I just have a Grolite at the moment. I'll take another look at the pinned topic. My frustration is getting a grate or slotted something to fit in the tank so that the pots can rest on top and receive the humidity.

On a sidenote, dormancy = death for every Petiolaris plant I ever had. Oddly enough, though, in spite of the constant moving around in the past couple weeks, my lanata, linifloras, and 2 neps aren't reacting. The lanata actually has dew on 4 leaves!

 

[jimscott]

No, that was tuberous sundews. Where did I see that topic?

 

[Pyro]

Hey Jim,

You can find light diffuser in the lighting section of Home Depot. It is a plastic grid about 45cm x 75cm and you can cut it to size using wire cutters or heavy duty scissors. Costs about $4 IIRC (been a while since I bought any). I am sure if you asked someone at HD they could direct you to it.

 

[jimscott]

Between our last posts I found something at the local dollar store that works. I bought 2 plastic containers that have one open end and 5 sides with 3/4" holes. I had to rotate one so that the two could fit together, which is good for adjusting the height, relative to the light and pot height.

2cm... how mant inches is that? Don't I have multiply or divide by 2.54 or 3.936?

So far the lanata seems happy enough to have dew.

 

[cmm889]

my 2nd cp ever was a lanata actually and I obviously totally unaware of the difference between sundews at the time, grew it just like every other normal drosera and it grew happily fully dewed for almost an entire year... I had it in a tray under a single cfl and it was happy as could be... until I had to rid it of my aphid infestation... it didnt appreciate the drowning to say the very least...

complete digression I know, but the thread got me to thinking how lucky it lived even that long...

 

[Pyro]

As for myself? To the ARCHIVES archives archives archives.... I couldn't find it via the public search and going through each back issue on the member's site would take forever. I don't think you can search them anyway. And I don't actually know the difference between the public search and the member's area.... dun dun duuuuun.

Alright, as promised I have found the CPN in question.

You want the March 2001 volume. Page 21. Article written by Mike Wilder.

What he describes in nearly identical to my set up with minor variation. I use more water and a slightly higher wattage heater than he describes.

 

[jimscott]

Travis, where's the picture of your setup? I can't find it here or across the Pond. I have a mental image of yours, Peter's, and Chuck's setups, but nothing I can look at.

actagggcagtgatatcccattggtacatggcaaat

Hey... is that a reference to Adenosine, Cytosine, Guanine, and Thiamine? No Uracil?

 

[Pyro]

Hey Jim,

Here is the link to my old set up:

http://www.terraforums.com/forums/showthread.php?t=107261&highlight=petiolaris,+How+I+grow

Only difference now is that I have the tanks set in their normal orientation as the silicon around the plexi sprung a leak and the water on the floor did not go over too well with my wife (not that I blame her for that reaction.)

Hey... is that a reference to Adenosine, Cytosine, Guanine, and Thiamine? No Uracil?

Yes it is a reference to DNA. No Uracil as that is for RNA but by asking you are moving in the right direction for translating it.

 

[jimscott]

I googled the strand all I got were several refernces to you, spanning a few forums... or is that fora!?

It's gonna be awhile before I can get hold of a camera, but mine is a fishtank filled with water. The two holey containers hold the heater down and allow for evaporation. The pots are less than one inch submerged. I have a Grolite ~4" above the pots. Considering all the jostling the liniflora, globosa, jacquelinae, and lanata have undergone, they all seem to like what's going on. The lanata now has 6 dewy leaves. This will also double as temporary triage for some lousy looking sundews!

 

[jimscott]

I just received a D. kenneallyi . Does this one like super hot temps?

 

[Pyro]

Treat kenneallyi like lanata

 

[jimscott]

That sounds promising, once it acclimates. Is D. indica considered Petiolaris Complex? I just received seeds thereof...