User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 7 of 8 FirstFirst ... 345678 LastLast
Results 49 to 56 of 59

Thread: N. rafflesiana... uppers!

  1. #49
    Admin- I'm growing CPs in the Desert of Tucson, Az. adnedarn's Avatar
    Join Date
    Jul 2001
    Location
    Tucson, Arizona USA
    Posts
    8,820
    Mentioned
    10 Post(s)
    Tagged
    1 Thread(s)
    MrFuss- this is the only one I can think of that looks like this too... Well, of the ones I can't explain lol

    Phisson- I've thought about cutting the tops off before, mainly for the reason you describe. Have anything lowland you'd be interested in trading for some? PM me Thanks for your opinions.
    Last edited by adnedarn; 11-04-2007 at 10:34 PM.
    -Andrew
    Owner of TerraForums, FlyTrapShop.com, and cpforums.org.
    Support FlyTrapShop, support TerraForums! www.flytrapshop.com

  2. #50
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,378
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hey all, I must agree with Phiss on a couple of points

    1) more light = better. Almost universally true
    2) BAD idea to grow raf as terrarium plant. They get BIG.

    As far as speed goes, mine grows in spurts. Couple of months xzooooom, couple of months in the pit stop mode. Not sure why. Seems to pitcher in batches, too. This is my big one, anyway. The babies are still too small for me to have formed an oppinion on their growth patterns.

    Glider, I should have broght my raf to the show, but there was just not more room in my car!
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  3. #51
    Do you like that... MrFus's Avatar
    Join Date
    Mar 2007
    Location
    Panama City Beach, FL
    Posts
    156
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    hey adnedarn do some of the leaves on your bellii have a tint of red on the leaves?

    N. Albomarginata, N. Ampullaria
    N. Bellii, N. Bicalcarata, N. Rafflesiana
    N. Sanguinea (Orange Pitcher), Cephalotus Follicularis
    .

    http://www.knology.net/~fus

  4. #52
    Admin- I'm growing CPs in the Desert of Tucson, Az. adnedarn's Avatar
    Join Date
    Jul 2001
    Location
    Tucson, Arizona USA
    Posts
    8,820
    Mentioned
    10 Post(s)
    Tagged
    1 Thread(s)
    Yes, quite red actually.
    -Andrew
    Owner of TerraForums, FlyTrapShop.com, and cpforums.org.
    Support FlyTrapShop, support TerraForums! www.flytrapshop.com

  5. #53
    Do you like that... MrFus's Avatar
    Join Date
    Mar 2007
    Location
    Panama City Beach, FL
    Posts
    156
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    On the past I have see plants get a red tint or even purple, The plants were under artificial lights so its only a guess to thinks the exposure to unfiltered light and/or level of UV have to do some on the coloration on leaves...

    N. Albomarginata, N. Ampullaria
    N. Bellii, N. Bicalcarata, N. Rafflesiana
    N. Sanguinea (Orange Pitcher), Cephalotus Follicularis
    .

    http://www.knology.net/~fus

  6. #54

    Join Date
    Apr 2006
    Location
    Ft. Worth, TX
    Posts
    2,251
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Think of the coloration as sunscreen. Its like when you go out in the sun and get a tan. The pigmentation is put there for protection.
    Z polski y dumny
    Prayer - how to do nothing and still think you're helping.
    http://www.youtube.com/watch?v=5F5aCUNE4Z8
    ^^^Newest vid

  7. #55

    Join Date
    Mar 2007
    Location
    Wilmington, NC
    Posts
    1,237
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Okay,well I am still thinking about trying some micro neps since it would be a waste to get a 50 gallon tank then have things outgrow it in months. I am thinking about doing a few thing like build a large polycarb indoor mini greenhouse that would take over my closet(that is emtey and has no door) but I think my mom would not like it unless it was perfect astetically. Maybe I dunno ,it would look good if I had plexiglass for the front,corragated for the back and sides. I grew ventricosa in hawaii sun all day long it had redish leafs,I killed things in hawaii like lots of things from the hawaii sun cp wise. I am going to work with my dad in hawaii(2 hours away from the nep nuseries) the ticket is bought so I am sorta his slave for 10 days. I will take some pics of some of the large native hawaiin garden and of the neps I gave her.
    Since there doing so well in her extremely hot(bright) greenhouse I wish she would order some from hilo but she is scared of getting a pest that is on that side of the island. I think she could grow bicals(many lowlanders) without trying Well in about 3 weeks I will show some pics of the garden. She has put like (If I can remember)$300,000 into the garden so it is a nice sight. Well I think that was why she was so scared of me having goats right down the street of her

  8. #56
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    There are actually a number of very experienced Nep growers who would argue that Neps grow and pitcher better under somewhat lower light conditions. The argument is that Neps rarely grow in fully exposed conditions in situ.

    FWIW in my years of growing I have found that my plants seem to do better under lower light conditions as well (i.e. 1m below the HID rather than the 0.5m below that gets best growth for other sun-loving plants like Helies and Drosera.) But that may just be my set up...

    One thing I like about my raff "giant" is that it adapted easily to growing as a windowsill plant. My beast is probably close to 1m tall and nearly as wide. Quite the weed
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 7 of 8 FirstFirst ... 345678 LastLast

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •