User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 3 of 3 FirstFirst 123
Results 17 to 20 of 20

Thread: ? about raff x ? seeds from tropics

  1. #17
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,378
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Hey all,

    I was just checking my rafs from Pyro's seeds....they can't be from the Feb. batch. I was wrong about the 3"....They're closer to 5". They must have come from a previous offer of the same seeds from Pyro.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  2. #18
    slightly askew
    Join Date
    Feb 2007
    Location
    Colorado
    Posts
    42
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Update to my luck so far with Pyro's generous give away. Took these this morning... with the cellphone so they arent great.



    The group, 7 total. Started with about 12.


    2 largest.


    the 2 smallest



    Some weak attempts at showing some sort of detail.

    As for coloring. The 2 smallest plants, the ones with the quarter, are coloring differently than the others. The leaves are kind of blushing a pale red and the "bellies" of the little pichers are also blushing. All of the plants look quite pale in the pics but the leaves are waxy looking and green. A few of the pitchers on one of the largest plants are getting red speckles.

    Received seeds mid March 07, germination early May 07.

    Thanks Pyro.
    Last edited by stacker; 11-12-2007 at 11:24 AM. Reason: added dates
    We must laugh at man to avoid crying for him. N. Bonaparte

  3. #19
    A yellow M&M Jefforever's Avatar
    Join Date
    Oct 2006
    Location
    over the rainbow (in the U.S.)
    Posts
    1,637
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Zero: Here's a link for the raff x ? seed I got: http://terraforums.com/forums/showthread.php?t=106856 .

    You sure you didn't recieve them from Pyro?

  4. #20
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    I am pretty sure he said he did get them from me early on in this thread after I posted that they came from me
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 3 of 3 FirstFirst 123

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •