User Tag List

Informational! Informational!:  0
Likes Likes:  0
Page 1 of 6 12345 ... LastLast
Results 1 to 8 of 41

Thread: Cantley's red, first pic: post your new baby

  1. #1

    Join Date
    Aug 2003
    Posts
    146
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    [img]http://home.**********.com/beagle/cantleysred1.jpg[/img]

    I've been afraid to post a pic. since I got it. This is the first nep I've ever gotten shipped to me where not one pitcher died. [img]http://www.**********.com/iB_html/non-cgi/emoticons/biggrin.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/wow.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/confused.gif[/img]

    Anyway, I don't want to mess up a good thing. But, in another thread I promised I'd let everyone know how it goes. I'm officially off the lowland deep end.

    What's your new "baby"?

  2. #2
    Guest
    I dont want to brag, but I have 23 new babies, and more coming [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img] . My favorites right now are my new N. faizaliana, N. northiana, N. rafflesiana giant, N. veitchii, N. rampsina (very beautiful), N. tentaculata (I've wanted one since my first nepenthes&#33[img]http://www.**********.com/iB_html/non-cgi/emoticons/wink.gif[/img], and N. stenophylla (one of my all time favorites, and very uncommon). I cant wait for the N. ampullaria giant, N. spectabilis giant, N. macrophylla, and N. hamata! I wish to the lord I had a digital camera [img]http://www.**********.com/iB_html/non-cgi/emoticons/sad.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/sad.gif[/img] [img]http://www.**********.com/iB_html/non-cgi/emoticons/sad.gif[/img] .

  3. #3

    Join Date
    Jun 2003
    Posts
    313
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Oh Beagle, that is stunning! I can see you're going to have a lot of fun with that one.

    My new babies are a N. truncata and a N. Sanguinea.

  4. #4

    Join Date
    Aug 2003
    Posts
    146
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    Oh sure, 23 children, no camera. What will you say when they leave their root systems one day? They grow up fast you know.

  5. #5
    swords's Avatar
    Join Date
    Apr 2002
    Location
    Cernunnos Woods
    Posts
    8,120
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    That's a very pretty N. ampullaria!

    What is the "giant" form of N. ampullaria? I don't remember having heard of it... Unless it's the Tayeve, form from Irian Jaya sold by Wistuba which is supposed to be larger than normal but how much larger I don't know.

    I don't know exactly what new babies I'm getting this fall. I never seem to get my full order, something is always "out". Some of what I ordered are:

    N. dubia
    N. talangensis
    N. sp. Doormans Top sp. 1 (from last order)
    N. rafflesiana gigantea (from last order)
    N. villosa (from last order)
    N. glabrata
    N. mira
    N. muluensis
    N. murudensis
    N. insignis (Tayeve form)
    N. ampullaria (Tayeve form)
    N. neoguineensis
    N. tentaculata (the Sulawesi form that looks like a toothless silver and purple hamata! )
    N. albomarginata (red form)
    N. reinwardtaina (highland red form)

    I forget the rest and my old PC burned up so I don't have any of my old files to look up! But total (not including the backordered ones from last order) it's about 30 plants that should arrive sometime between Oct-Nov.

  6. #6
    Moderator
    Join Date
    Jun 2002
    Location
    Westchester County, New York
    Posts
    5,377
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    My newest additions are my highlanders: fusca, faiziliana (which may turn out to me another variety of fusca....read that in a previous thread), x 'Ventrata', macfarlenei, alata, khasiana and aristichioides.

    You can see a pic of the set up in the terrariums forum.
    17 Nash Rd.
    North Salem, NY 10560

    YOU! Outta my gene pool!

  7. #7

    Join Date
    Jan 2003
    Location
    Palm Springs, CA
    Posts
    840
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    My new "babies" are N. hareliana var. 'Red Skelton', and N. xTomomi x xTiveyi. [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    Lithops care info: If you take care of it, it will die.

  8. #8
    N=R* fs fp ne fl fi fc L Pyro's Avatar
    Join Date
    Aug 2001
    Location
    Maryland
    Posts
    4,844
    Mentioned
    0 Post(s)
    Tagged
    0 Thread(s)
    My new babies are diatas, inermis, lowii and gymnamphora. And I have a jacquelinae on the way [img]http://www.**********.com/iB_html/non-cgi/emoticons/smile.gif[/img]
    'My love was science- specifically biology and, more specifically, when placed in a common jar, which of two organisms would devour the other.'

    See You Space Cowboy

    actagggcagtgatatcccattggtacatggcaaattagcctcatgat
    Hagerstown, Maryland

    --
    actagggcagtgatatcccattggtacatggcaaattagcctcatgat

Page 1 of 6 12345 ... LastLast

Similar Threads

  1. The terraforums Post Presidential debate post
    By swords in forum General Discussions
    Replies: 30
    Last Post: 09-30-2008, 06:46 PM
  2. Rob cantley, where are you gone?
    By Marcello Catalano in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 2
    Last Post: 03-01-2005, 07:57 AM
  3. Cantley's red
    By Tamlin Dawnstar in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 32
    Last Post: 10-27-2004, 05:54 AM
  4. What chi'en lee & bob cantley forgot to tell you
    By kltower in forum Tropical Pitcher Plants  (Nepenthes)
    Replies: 1
    Last Post: 04-19-2004, 07:34 PM
  5. nep ampullaria cantley's red
    By olivier marthaler in forum Carnivorous Plant Trading Post
    Replies: 3
    Last Post: 02-19-2004, 06:04 AM

Tags for this Thread

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •